ChIP was done following previously protocol (Shen, 2008). Briefly, cell were crosslinked on plate with 0.9% FMA for 10 min, then quenched by 1/20 volume of 2.5 M glycine. after two times of ice cold PBS wash, cell were harvested by trypsin digestion, and lysis by 1 x nuclei lysis buffer. Then Sonicated into average size 200-500 bp. 14000rpm for 15 min, supernatant were diluted by ChIP dilution buffer. 3 ug H3K4me3 (Abcam, ab8580) or H3K27me3 antibodies (Millipore, #07-449) were added, 4℃, end to end rotate overnight. 30 ul Protein AG UltraLink Resin (Thermo, 53133) were added, 4℃, end to end rotate for 3 times. after thoroughly wash, the DNA were eluted by elution buffer with protease K at 65℃. The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, ChIRP retrieved DNA was end repaired, and dA-tailed by respect module according to respect instruments. The DNA product then ligated with adaptor with NEBNext Quick Ligation Module. The adaptor for the libary were sythersized from IDT with the first 7nt is "ACTGACT" as a barcode. After liagation, the DNA were amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Genome Analyzer following the manufacturer's protocols. Total RNA of RNA-Seq were extracted by TRIzol reagent according to manufacturer's instruction. mRNA were further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instruction. Libraries were prepared by illumina TruSeq Stranded mRNA LT Sample Prep Kit (RS-122-2101) according to the standard protocols of the manufacturer. ChIRP retrieved DNA-seq were prepared by library preparation modules (New England Biolabs) according to manufacturer's instructions.