RNA-Seq: RNA was extracted from Nup153 knockdown and control mESCs using Trizol (Ambion) and column purified using RNeasy kit (Qiagen). For ChIP-seq, approximately 107 cells were cross-linked with 1% formaldehyde at room temperature for 10 min and neutralized with 0.125 M glycine. After sonication, 20–30 µg of soluble chromatin was incubated with 5–10 μg of antibody at 4°C overnight. Immunoprecipitated complexes were collected using Dynabeads M280 sheep-anti-rabbit IgG or sheep-anti-mouse IgG (Invitrogen). Subsequently, immuno-complexes were washed, and DNA was extracted and purified by QIAquick Spin columns (Qiagen). For DamID-Seq, mECS were harvested and gDNA was isolated using the Qiagen DNeasy Blood & Tissue Kit. 3μg of gDNA was then digested with 0.5μl of DpnI (NEB, 20 U/ μl) and ligated with the adaptor AdR, which was made by mixing and slowly annealing AdR-top (5’ CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA 3’) and AdR-bottom (5’ TCCTCGGCCG 3’). This ligation was completed using 1uL T4 Ligase (Roche, 5U/μl) for 2 hours at 16°C. The regions flanked by adaptors were amplified by PCR using the Bio-Adr-primer (5’ Bio-GGTCGCGGCCGAGGATC 3’) and purified using the Qiagen MinElute PCR purification kit. 4μg of amplified products were sonicated using a Bioruptor (Diagenode) to obtain DNA fragments of sizes between 100-500bp. Dynabeads MyOne Streptavidin T1 (Invitrogen) beads were used to pull down the biotinylated ends of the sonicated PCR products. The bound DNA was removed off the beads by digestion with DpnII at 370C for 1 hour and cleaned using the MinElute PCR Purification kit. RNA-Seq strand-specific libraries were generated from total RNA with polyA+ selection of mRNA using the TruSeq Stranded RNA LT Kit (Illumina). ChIP-Seq and DamID-Seq libraries were generated using the TruSeq ChIP sample Prep kit (Illumina) followed by deep sequencing with the Illumina’s HiSeq 2500 system. ChIP-Seq, DamID-Seq, and strand-specific polyA+ RNA-seq