Lysates were clarified from sonicated nuclei and were incubated with anti-flag M2 affinity gel (Sigma, A2220) to isolate the immune complexes (flag-PGR-A and flag-PGR-B). The immunocomplexes were eluted from the beads using flag-peptide and heated at 65°C for 6 h to reverse the cross-linking. Following digestions with RNAase A and proteinase K, DNA fragments were purified using QIAquick PCR purification kit (Qiagen). The ChIPseq libraries were prepared with Illumina's 'TruSeq DNaseq Sample Prep kit'.The libraries were quantitated by qPCR, and sequenced for 100 cycles on a HiSeq2000 using a TruSeq SBS sequencing kit version 3 and analyzed with Casava1.8 (pipeline 1.8). Sequence adapters used the make the libraries: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG. Library construction and base-calling were performed by Roy J. Carver Biotechnology Center, UIUC.