GRO-seq: GRO-seq was performed as previously described (Core et al. 2008; Wang et al. 2011). Cells were washed twice with ice-cold PBS, then swelled in swelling buffer (10 mM Tris pH 7.5, 2 mM MgCl2, 3 mM CaCl2) for 5 min on ice. Cells were centrifuged at 400g for 10 min, then resuspended in lysis buffer (swelling buffer with 10% glycerol and 1% Igepal) and incubated on ice for 5 min. Nuclei were washed twice with lysis buffer, then resuspended in freezing buffer (50 mM Tris pH 8.3, 40% glycerol, 5 mM MgCl2, 0.1 mM EDTA). Nuclei were counted, pelleted, and 5 x 106 nuclei were resuspended in 100 μl freezing buffer. For each library, run-on was performed on 4 tubes of 5 x 106 nuclei. For the run-on, cells were mixed with an equal volume of run-on buffer (10 mM Tris pH 8.0, 5 mM MgCl2, 1 mM DTT, 300 mM KCl, 20 units of SUPERase-In, 1% Sarkosyl, 500 μM ATP, GTP and Br-UTP, 2 μM CTP) and incubated for 5 min at 30°C. Nuclear RNA was extracted with TRIzol (Invitrogen) and precipitated with NaCl and ethanol overnight. The pellet was resuspended in water and the RNA was DNase treated (Ambion) for 30 min. RNA was hydrolyzed using fragmentation reagents (Ambion) for 13 min at 70°C and purified through a Micro Bio-Spin p-30 column (Bio-Rad) according to manufacturer’s instructions. RNA was treated with 1.5μl T4 polynucleotide kinase (New England Biolabs) for 1h at 37°C, then with an additional 1μl for 1h more. RNA was denatured for 5 min at 65°C. Anti-BrU agarose beads (Santa Cruz) were rotated for 1h in blocking buffer (0.5x SSPE, 1 mM EDTA, 0.05% Tween-20, 0.1% PVP, and 1 mg/ml BSA). Run-on RNA was rotated with beads for 1h, followed by washes twice in binding buffer (0.5x SSPE, 1 mM EDTA, 0.05% Tween-20), twice in low salt buffer (0.2x SSPE, 1 mM EDTA, 0.05% Tween-20), once in high salt buffer (0.5x SSPE, 1 mM EDTA, 0.05% Tween-20, 150 mM NaCl), and twice in TET buffer (TE pH 7.4, 0.05% Tween-20). BrU-labeled RNA was eluted from the beads four times for 15 min with 100 μl elution buffer pre-heated to 42°C. RNA was ethanol-precipitated overnight. GRO-seq: Precipitated RNA was resuspended in water, denatured, and treated with poly(A)-polymerase (NEB) for 30 min at 37°C. cDNA synthesis was performed as described previously (Wang et al, Nature 2011) using oNTI223 primer ((5′-pGATCGTCGGACTGTAGAACTCT;CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′) where the p indicates 5′ phosphorylation, ‘;’ indicates the abasic dSpacer furan and VN indicates degenerate nucleotides. The reaction was treated with 3 μl exonuclease I (Fermentas) for 15 min at 37°C, followed by 2 μl 1M NaOH for 20 min at 98°C, and neutralized with 1μl 2M HCl. cDNA was run on 10% TBE-urea gel, then products were excised and eluted from shredded gel pieces for 4h in TE + 0.1% Tween and precipitated in ethanol overnight. First-strand cDNA was circularized with CircLigase (Epicentre), denatured for 10 min at 80°C, and relinearized with APE I (NEB). Linearized DNA was amplified by PCR using Phusion Hot Start II Kit, according to manufacturer’s instructions. The oligonucleotide primers oNTI200 (5′-CAAGCAGAAGACGGCATA-3′) and oNTI201 (5′-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACG-3′) were used for amplification. The PCR product was run on a 10% TBE gel and eluted as before. Libraries were sequenced on an Illumina hi-Seq2000 with sequencing primer 5′-CGACAGGTTCAGAGTTCTACAGTCCGACGATC-3′.