Spleen was isolated and target cells were sorted using FACS; genomic DNA was isolated with the DNEasy Blood and Tissue Kit The assay for transposase-accessible chromatin using sequencing (ATAC-seq) was performed according to32 with some modifications. In brief, about 50,000 FACS-isolated cells were pelleted on with 10,000xg for 3 min and supernatant removed. Cells were tagmented at 55°C for 8 min in 50 µl 1x tagmentation buffer including 2.5 µl transposome from the Nextera DNA library prep kit and 0.01% digitonin. The transposome was inactivated by addition of 20 µl 5M guanidinium thiocyanate, and the DNA was purified with two volumes, i.e., 140 µl, of DNA-binding beads (HighPrep beads). The DNA was PCR amplified with a LightCycler 480 (Roche) in a 50 µl reaction with the NEBNext High Fidelity mix including 0.5 µl 1x SYBRGreen, forward primer Tn5McP1n (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC) and barcoded reverse primers Tn5mCBar (CAAGCAGAAGACGGCATACGAGAT (8-9N barcode) GTCTCGTGGGCTCGG); 72°C, 5 min; 98C, 30 sec (gap repair and initial melting); then cycling with 98°C, 10 sec; 63°C, 30 sec; 72°C, 30sec for 15 cycles when all amplifications turned into saturation. PCR products were purified with 1.4 volumes (70 µl) magnetic beads. Ten µl eluates were sequenced on a HiSeq2000, 125 bp paired-end. ATAC-seq read data were processed as described previously (reference see original publication). Reads were trimmed using Skewer and aligned to the mm10 assembly of the murine genome using Bowtie2 with the '-very-sensitive' parameter. Duplicate reads were removed using sambamba markdup, and only properly paired reads with mapping quality >30 were kept. Bigwig files were created using bedtools.