Antigen

Antigen Class

Unclassified

Antigen

Unclassified

Cell type

Cell type Class

Blood

Cell type

Macrophages

MeSH Description

The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)

Sample

source_name

mouse thioglycollate elicited macrophage cells

tissue

mouse thioglycollate elicited macrophage cells

Sex

male

treatment

KLA-1h

genotype

Balb/cJ

antigen target

Atf3 (PA5-36244)

library prep

ChIP

Sequenced DNA Library

library_strategy

ChIP-Seq

library_source

GENOMIC

library_selection

ChIP

library_construction_protocol

Protein A and G Dynabeads 50/50 mix from Invitrogen are sued for ChIP (10001D, 10003D). IP mix consists of 20ul beads/2ug antibody per 2 million cell ChIP. For preparation, beads were washed with 0.5%BSA-PBS (BSA: , then incubate beads-antibody with 0.5%BSA-PBS for at least 1h on rotator (4oC). Wash 2X with 0.5%BSA-PBS, then resuspend in dilution buffer. Double Crosslinking for ChIP. Media was decanted from cells in 10 cm plates, wash once briefly with PBS (RT). Disuccinimidyl glutarate (Pierce Cat # 20593) (diluted in DMSO at 200mM)/PBS (RT) was used for 10 min. Then Formaldehyde was added to a final concentration of 1% for an additional 10 min. Reaction was quenched with 1:10 Tris pH 7.4 on ice. Cells were collected and washed twice with cold PBS, spinning at 1000 rcf for 5 min. Nuclei Isolation and Sonication. Resuspend cell pellets in 1 ml of Nuclei Isolation Buffer (50 mM Tris-Ph 8.0, 60 mM KCl, 0.5% NP40) + PI and incubate on ice for 10 minutes. Centrifuge 2,000 g for 3 minutes at 4º C. Resuspend nuclei in 200 ul of fresh Lysis Buffer (0.5% SDS, 10 mM EDTA, 0.5 mM EGTA, 50 mM Tris-HCl (ph8))+ PI. Sonication. Nuclei were then sonicated (10 million cells) for 25 minutes in a Biorupter (settings= 30 seconds=On, 30 seconds=Off, Medium) using thin wall tubes (Diagenode Cat# C30010010). After sonication spin max speed for 10 minute at 4C. ChIP set up. Sonicated DNA was diluted 5X with 800 Dilution Buffer (1% Triton, 2mM EDTA, 150 mM NaCl, 20 mM Tris-HCl (ph8), 1X Protease Inhibitors). An aliquot is removed for input samples (5%). Samples ON at 4º C while rotating. Washing. ChIP are washed 1X with TSE I (20mM Tris-HCl pH7.4, 150mM NaCl, 0.1%SDS, 1% Triton X-100, 2mM EDTA), 2X with TSE III (10mM Tris-HCl pH7.4, 250mM LiCl, 1%IGEPAL, 1%Deoxycholate, 1mM EDTA), 1X with TE+0.1%TritonX-100, transfer to new tube and then wash another time with TE+0.1%TritonX-100.   Elution. Elute with 200 uL Elution Buffer (1% SDS, 10mM Tris pH7.5) for 20 minutes at RT, shaking on the vortex or a nutator or rotator. De-crosslinking. Add 10 uL of 5 M NaCl and incubate ON at 65º C (or at least 8 hours). Clean up samples using Zymo ChIP DNA Clean & Concentrator. Elute in 100uL. Take 40uL and proceed to library prep protocol. dsDNA End Repair. We mixed 40uL of DNA from ChIP or RNA protocols with 2.9uL of H2O, 0.5uL 1% Tween-20, 5uL 10X T4 ligase buffer (Enzymatics cat# L6030-HC-L), 1uL dNTP mix (10 mM Affymetrix 77119), 0.3 uL T4 DNA pol (Enzymatics P7080L), 0.3uL T4 PNK (Enzymatics Y9040L), 0.06uL Klenow (Enzymatics P7060L) and incubated for 30min at 20°C. 1uL of Seradyn “3 EDAC” SpeedBeads (Thermo 6515-2105-050250) in 93 μL 20% PEG8000/2.5 M NaCl (13% final) was added and incubated for 10 min. Bead clean-up. Beads were collected on a magnet and washed 2X with 80% ethanol. Beads were air-dried for 10 min and then eluted in 15uL ddH2O. dA-Tailing. DNA was mixed with 10.8uL ddH2O, 0.3uL 1% Tween-20, 3uL Blue Buffer (Enzymatics cat# B0110L), 0.6uL dATP (10mM Tech 10216-018), 0.3uL Klenow 3'- 5' Exo (Enzymatics P7010-LC-L) and incubated for 30min at 37°C. 55.8uL 20% PEG8000/2.5 M NaCl (13% final) was added an incubated for 10 min. Then bead clean up was done. Beads were eluted in 14uL. Y-Shape Adapter Ligation. Sample was mixed with 0.5uL of a BIOO barcode adapter (BIOO Scientific cat# 514104), 15uL Rapid Ligation Buffer (Enzymatics cat@ L603-LC-L), 0.33uL 1% Tween-20 and 0.5uL T4 DNA ligase HC (Enzymatics L6030-HC-L) and incubated for 15 min at RT. 7 μL of 20% PEG8000/2.5 M NaCl was added and incubated for 10min at RT. Bead clean up was performed and beads were eluted in 21uL. 10uL was then used for PCR amplification (14 cycles) with IGA and IGB primers (AATGATACGGCGACCACCGA, CAAGCAGAAGACGGCATACGA).

Sequencing Platform

instrument_model

Illumina HiSeq 4000

mm10

Number of total reads

28141465

Reads aligned (%)

96.3

Duplicates removed (%)

46.4

Number of peaks

34755 (qval < 1E-05)

mm9

Number of total reads

28141465

Reads aligned (%)

96.2

Duplicates removed (%)

46.5

Number of peaks

34726 (qval < 1E-05)