Dermal female fibroblasts (XaWT Xi[delta]Xist). Genetic manipulation: Post XCI deletion of Xist on inactive X-chromosome
strain
CAST/Ei x 129/Sv/Jae
cells
Differentiated dermal female fibroblast cells
Sex
female
Sequenced DNA Library
library_strategy
ChIP-Seq
library_source
GENOMIC
library_selection
ChIP
library_construction_protocol
Approximately 50 × 106 cells were washed in PBS, scraped in lysis buffer (10 mM Tris-HCl pH7.5, 30 mM NaCl, 0.1% NP40, 3 mM MgCl2 and proteinase inhibitor cocktail (Roche)) and incubated for 10 min on ice. After centrifugation, nuclei pellets were resuspended in benzonase buffer (50 mM Tris pH 7.5, 300mM NaCl, 0.5% NP40, 2.5mM MgCl2 and proteinase inhibitor cocktail). Chromatin was digested by adding 125 units of benzonase (Sigma) for 30 min on ice and was spun at 16,000g at 4ºC. Benzonase digestion was stopped by diluting twice the supernatants in 50 mM Tris pH 7.5, 100mM NaCl, 0.5% NP40, 15mM EDTA containing proteinase inhibitor cocktail. After pre-clearing step using 100 uL Dynabeads protein G magnetic beads (Invitrogen), the chromatin was incubated with 4 ug of either anti-BRG1 (ab110641) or anti-IgG (Cell signaling, 2729S) antibodies pre-bound to 50 ul Dynabeads protein-G magnetic beads (Invitrogen) rotating for 4 hr at 4C. An aliquot of untreated chromatin was processed in parallel and used as the total input DNA control. Beads were washed 3 times in 50 mM Tris pH 7.5, 150 mM NaCl, 0.5% NP40, 5mM EDTA, followed by 3 times in 50 mM Tris pH 7.5, 500 mM NaCl, 0.5% NP40, 5mM EDTA. DNA was eluted twice by incubation in elution buffer (1% SDS, 0.1M NaHCO3) for 15 min. DNA was subjeced to RNase and proteinase K digestion and then purified. For sequencing, 10 ng of IP or input DNA was used for ChIP-seq library construction using NEBNext Ultra DNA Library Prep Kit for Illumina. Libraries were assessed for quality control on the BioAnalyzer 2100 (Aglient). Sequencing was performed on the HiSeq 2500 (Illumina), using 50 bp paired-end reads. NEBNext adapters F: GATCGGAAGAGCACACGTCTGAACTCCAGTC, R: ACACTCTTTCCCTACACGACGCTCTTCCGATCT