ATAC-seq - Nuclei from ~50,000 cells were isolated using NP-40-containing buffer. Extracted nuclei were treated with transposed with Nextera (illumina) Tn5 transposase for 30 minutes. Following clean-up transposed fragments were directly amplified and barcoded using Nextera indexes. Libraries were then sequenced using Illumina NextSeq 500 with 2x75 bp or 2x35 reads. Nuclear RNA-seq - Nuclei were obtained from 16 million cells per sample by incubation in 4 ml 50 mM Tris-HCl pH 7.5, 140 mM NaCl, 1.5 mM MgCl2, 1 mM DTT, 0.4% NP40, 5 min on ice, followed by a wash with the same solution without NP40. RNA was isolated with RNeasy mini kit (Qiagen) and treated with Turbo DNase (Ambion). RNA was depleted of Ribosomal RNA with RiboZero-gold (Illumina). Stranded RNA-seq libraries were prepared following standard second-strand dU incorperating protocols (Parkhomchuk et al., 2009). Kappa-VJ-seq - RNA was extracted from cells with Highpure RNA isolation kit (Roche). RNA was poly-A enriched using poly-dT beads (Life technologies) in two selection cycles and RT then performed using AffinityScript QPCR cDNA Synthesis Kit (Agilent) with an RT primer specific for the Cκ region 5’-ATGCTGTAGGTGCTGTCTTT-3’. The residual RNA was degraded with 0.1N NaOH, neutralized with 0.1M acetic acid and the single strand cDNA then purified using Silane beads (Life technologies). A 3TR3 adapter ('5-/Phos/ AGATCGGAAGAGCACACGTCTG/3SpC3/-3') was ligated to the 3’ end by overnight incubation with T4 RNA ligase (NEB) at 22°C, and the cDNA then purified from excess adapter with Silane beads and PCR amplified for 12 cycles using the reverse complement of the 3RT3 adapter as the forward primer and the upstream Cκ region as the reverse primer with the partial Truseq illumina adapter added to the beginning (5’-TACACGACGCTCTTCCGATCT-ACTGGATGGTGGGAAGATGGAT-3’). The PCR product was cleaned with 0.7x ampure XT beads, amplified with indexed universal Illumina adapter primers for an additional 7 cycles to obtain ~550 bp libraries.