Genomic tail DNA was isolated by standard procedures (Laird, P.W. et al. Nucleic Acids Res. 1991, 19:4293). Genomic sperm DNA was isolated by standard procedures (Griffin J. Methods Mol Biol. 2013, 927:379-384.). Genomic oocyte DNA was isolated by standard procedures (Smallwood, S.A. et al. Nat. Methods 2014, 11:817-820). DNA from tail and sperm were phenol chlorform extracted before bisulfite treatment. 75ng of purified BS-PCR product was end polished (End-IT kit #ER0720) for 45 minutes, A-tailed (NEB Klenow exo- # M0212L) for 50 minutes, and ligated with TruSeq adapters. This product was subjected to 10 rounds of amplification with barcode-specific primers (AATGATACGGCGACCACCGA and CAAGCAGAAGACGGCATACGA) and gel purified before sequencing. Ampure beads (Agencourt #A63880) were used to clean up between steps.