Epiblast cells were isolated from E6.25 pre-gastrulating embryos coming from outbred MF1 females crossed with ΔPE-Oct4-EGFP (GGOF) stud males. After recovering embryos from the decidua, Reichert’s membrane was dissected out and extraembryonic cone was also removed. Remaining tissue was used to prepare single cell suspension and sorting using MoFlo high-speed cell sorter (Beckman Coulter) based on EGFP expression. lcChIP-seq was performed by using a modified published method (Ng et al., 2013). Isolated DNA was primed using WGA4 kit (Sigma). The next step involved library amplification using HiFi Library Amplification master mix (Kappa biosciences) and BpmI-primer (CCGGCCCTGGAGTGTTGGGTGTGTTTGG). These reactions were incubated in a thermocycler using following conditions: 98 °C for 3 min; 11-12 X (98 °C for 10 sec; 65 °C for 30 sec; 72 °C for 1 min); 72 °C for 7 min: or 4 °C as suggested. The number of cycles depended on the amount of DNA precipitated and so 11 cycles were used for H3K9me2 and 12 for H3K27me3. Amplified DNA was purified with Agencourt RNA clean XP beads. Adapter trimming was performed by BpmI digestion, secondary adaptor ligation and a second round of digestion (Ng et al., 2013). Digested DNA was purified with Agencourt RNA clean XP bead and used for library preparation using Ovation Ultralow DR Multiplex System (0331, Nugen).