Sample information curated by ChIP-Atlas


Antigen Class
TFs and others

Cell type

Cell type Class
Cell type

Attributes by original data submitter


Broker name
Protocols: CRISPR mediated KO of CIC: sgRNAs (Target sequence: mESCs: GCCTTCATGATCTTCAGCAAG; G144: GGGCGAGTGGTGGTATGCCC) were cloned into pSpCas9(BB)-2A-GFP (Addgene 48138) and transfected into mESCs (Lipofectamine 2000) or G144 cells (Amaxa Nucleofector II, Program A033). GFP-positive cells were single cell sorted 48h post-transfection, expanded and screened by immunoblotting for CIC deletion. MEK inhibition: Inhibitor treatment with 1 μM MEK inhibitor (PD0325901) was performed in 80% confluent cultures for 4 and 24 h respectively. DMSO was used as mock control. Cells were cross-linked (1% formaldehyde, 10 minutes), quenched with 125 mM glycine, washed twice with PBS and harvested in SDS buffer (50 mM Tris at pH 8.1, 0.5 % SDS, 100 mM NaCl, 5 mM EDTA). Cells were pelleted, resuspended in Triton-X IP buffer (100 mM Tris at pH 8.6, 0.3% SDS, 1.7% Triton X-100, and 5 mM EDTA) and chromatin was sonicated (fragment size 200-500bp). 25 µg chromatin (measured by Bradford) was pre-cleared with protein-A Sepharose beads (GE healthcare) for 1 hour and incubated with primary antibody overnight at 4oC. Protein-A Sepharose beads were blocked with 10 µg/ml BSA overnight at 4°C. Next day, beads and antibody/chromatin-mixture were incubated for 3 hours at 4oC. Beads were washed 3x with low salt buffer (1% Triton X-100, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, pH 8.0, 20 mM Tris-HCl, pH 8.0) and twice with high salt buffer (1% Triton X-100, 0.1% SDS, 500mM NaCl, 2 mM EDTA, pH8.0, 20 mM Tris-HCl, pH8.0). DNA was eluted with elution-buffer (1% SDS, 0.1 M sodium bicarbonate) at 65oC overnight and purified using QIAquick PCR Purification Kit (Quiagen). For ChIP-seq 1-2 ng of ChIP DNA was used for library preparation, using the NEBNext Ultra II DNA library prep kit (E7370; NEB).
ENA checklist
INSDC center alias
BRIC - Biotech Research and Innovation Centre
INSDC center name
BRIC - Biotech Research and Innovation Centre
INSDC first public
INSDC last update
INSDC status
SRA accession
Sample Name
glial cell
developmental stage
glioblastoma multiforme
CRISPR/Cas9 mediated knockout of CIC
Homo sapiens
organism part

Sequenced DNA Library

CRISPR mediated KO of CIC: sgRNAs (Target sequence: mESCs: GCCTTCATGATCTTCAGCAAG; G144: GGGCGAGTGGTGGTATGCCC) were cloned into pSpCas9(BB)-2A-GFP (Addgene 48138) and transfected into mESCs (Lipofectamine 2000) or G144 cells (Amaxa Nucleofector II, Program A033). GFP-positive cells were single cell sorted 48h post-transfection, expanded and screened by immunoblotting for CIC deletion. MEK inhibition: Inhibitor treatment with 1 μM MEK inhibitor (PD0325901) was performed in 80% confluent cultures for 4 and 24 h respectively. DMSO was used as mock control. Cells were cross-linked (1% formaldehyde, 10 minutes), quenched with 125 mM glycine, washed twice with PBS and harvested in SDS buffer (50 mM Tris at pH 8.1, 0.5 % SDS, 100 mM NaCl, 5 mM EDTA). Cells were pelleted, resuspended in Triton-X IP buffer (100 mM Tris at pH 8.6, 0.3% SDS, 1.7% Triton X-100, and 5 mM EDTA) and chromatin was sonicated (fragment size 200-500bp). 25 µg chromatin (measured by Bradford) was pre-cleared with protein-A Sepharose beads (GE healthcare) for 1 hour and incubated with primary antibody overnight at 4oC. Protein-A Sepharose beads were blocked with 10 µg/ml BSA overnight at 4°C. Next day, beads and antibody/chromatin-mixture were incubated for 3 hours at 4oC. Beads were washed 3x with low salt buffer (1% Triton X-100, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, pH 8.0, 20 mM Tris-HCl, pH 8.0) and twice with high salt buffer (1% Triton X-100, 0.1% SDS, 500mM NaCl, 2 mM EDTA, pH8.0, 20 mM Tris-HCl, pH8.0). DNA was eluted with elution-buffer (1% SDS, 0.1 M sodium bicarbonate) at 65oC overnight and purified using QIAquick PCR Purification Kit (Quiagen). For ChIP-seq 1-2 ng of ChIP DNA was used for library preparation, using the NEBNext Ultra II DNA library prep kit (E7370; NEB).

Sequencing Platform

NextSeq 500


Number of total reads
Reads aligned (%)
Duplicates removed (%)
Number of peaks
928 (qval < 1E-05)


Number of total reads
Reads aligned (%)
Duplicates removed (%)
Number of peaks
1238 (qval < 1E-05)

Base call quality data from DBCLS SRA