ChIRP was done as described previously with the following modifications (Chu et al. 2011). First, 59 nt DNA probes were biotinylated through terminal transferase (New England Biolabs). Intensive crosslinking of cells was performed in the following sequence: two rounds of 3000J UV treatment on ice, 0.8% of formaldehyde (FMA) for 10 minutes, 2mM of DSP (Dithiobis [succinimidyl propionate]) for 30 minutes, and followed by 3.7% of FMA for 10 minutes at room temperature. Crosslinked cell pellets were lysed. Chromatin was fragmented into a range of 2 - 5 kb by sonication. Hybridization, washing and elution steps were performed as described previously, except that we included an additional stringent wash (0.1x SSC). After elution and reverse crosslinking, RNA was further extracted by TRIzol reagent (Life Technologies). The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, ChIRP retrived RNA was fragmentated by NEBNext Magnesium RNA Fragmentation Module at 94 ℃ for 210 seconds. The fragementated RNA was reverse transcribed by SuperScript III First-Strand Synthesis System for RT-PCR kit (Life Technology), 2'nd strand was then synthesized by NEBNext mRNA Second Strand Synthesis Module , the end repair, dA-tailing and adaptor ligation were also following the instruments by respect module. the adaptor for the libary was sythersized from IDT with the first 7nt is "TCACGTT" as a barcode. After liagation, the DNA was amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Genome Analyzer following the manufacturer's protocols. Total RNA of RNA-Seq were extracted by TRIzol reagent according to manufacturer's instruction. mRNA were further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instruction. Libraries were prepared by illumina TruSeq Stranded mRNA LT Sample Prep Kit (RS-122-2101) according to the standard protocols of the manufacturer. ChIRP retrieved DNA-seq were prepared by library preparation modules (New England Biolabs) according to manufacturer's instructions.