Sample information curated by ChIP-Atlas

Antigen

Antigen Class
ATAC-Seq
Antigen
ATAC-Seq

Cell type

Cell type Class
Blood
Cell type
Hematopoietic Stem Cells
MeSH Description
Progenitor cells from which all blood cells derived. They are found primarily in the bone marrow and also in small numbers in the peripheral blood.

Attributes by original data submitter

Sample

source_name
LT-HSC sorted from aged mouse (daughter cell)
strain
B6.SJL mice
tissue
Long-term Hematopoietic stem cells (LT-HSC)

Sequenced DNA Library

library_strategy
ATAC-seq
library_source
GENOMIC
library_selection
other
library_construction_protocol
cells were separated by pipetting and singularly subjected to fragmentation of open chromatin-regions using Tn5 transposase (Illumina), followed by a pre-amplification step, library preparation and subsequent paired-end sequencing. For the pre-amplification step, NEBNext Ultra II Q5 Master Mix was used with Primer 1: 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3' and Primer 2: 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3'. For dual-indexing, 10 μL of the pre-amplified ATAC reaction was used as input for Nextera index kit (Illumina). The generated libraries were quantified using agilent bio-analyzer and qPCR kit (New England Biolabs).

Sequencing Platform

instrument_model
Illumina HiSeq 3000

mm10

Number of total reads
3024657
Reads aligned (%)
17.1
Duplicates removed (%)
60.9
Number of peaks
35 (qval < 1E-05)

mm9

Number of total reads
3024657
Reads aligned (%)
17.0
Duplicates removed (%)
60.9
Number of peaks
29 (qval < 1E-05)

Base call quality data from DBCLS SRA