Sample information curated by ChIP-Atlas


Antigen Class

Cell type

Cell type Class
Cell type
Hematopoietic Stem Cells
MeSH Description
Progenitor cells from which all blood cells derived. They are found primarily in the bone marrow and also in small numbers in the peripheral blood.

Attributes by original data submitter


LT-HSC sorted from aged mouse (daughter cell)
B6.SJL mice
Long-term Hematopoietic stem cells (LT-HSC)

Sequenced DNA Library

cells were separated by pipetting and singularly subjected to fragmentation of open chromatin-regions using Tn5 transposase (Illumina), followed by a pre-amplification step, library preparation and subsequent paired-end sequencing. For the pre-amplification step, NEBNext Ultra II Q5 Master Mix was used with Primer 1: 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3' and Primer 2: 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3'. For dual-indexing, 10 μL of the pre-amplified ATAC reaction was used as input for Nextera index kit (Illumina). The generated libraries were quantified using agilent bio-analyzer and qPCR kit (New England Biolabs).

Sequencing Platform

Illumina HiSeq 3000


Number of total reads
Reads aligned (%)
Duplicates removed (%)
Number of peaks
52 (qval < 1E-05)


Number of total reads
Reads aligned (%)
Duplicates removed (%)
Number of peaks
44 (qval < 1E-05)

Base call quality data from DBCLS SRA