ChIPs were performed according to the Millipore ChIP protocol, as described previously (De Gobbi et al., 2007). For ChIP-Seq experiments, Ter119+ cells were fixed with 1% formaldehyde for 10 minutes at RT and chromatin was sonicated to a size <500 bp. Immunoprecipitations were performed, after an overnight incubation with the appropriate antibody, with protein A agarose (Millipore). A sample containing no antibody was used as a negative control. Input and immunoprecipitated DNA were purified by phenol and chloroform extraction followed by ethanol precipitation. Subsequently the material was analysed by real time PCR (ABI Prism 7000 Sequence Detection System, Applied Biosystems) using a series of PCR amplicons and 5'FAM-3'TAMRA probes across the alpha-globin locus. Libraries were constructed using the NEBNext DNA Sample Prep Kit (NEB) with the following modifications: End Repair was performed with 1µl of Enzyme mix and adapters were ligated using 4µl of Ligase. We used 10µl of a 1 in 100 dilution of Illumina Adapters (Multiplexing Sample Preparation Oliogonucleotide Kit) for 10ng of DNA and amplified with 25 µM each of the following custom primers: PCR primer 1.0 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT TCCGATCT-3' Index primer 5'-CAAGCAGAAGACGGCATACGAGAT[INDEX]CAGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCT-3' *Indexes were according to the six bases tags developed by Illumina. The amplified libraries were purified using Ampure beads and size selected using 2% E-Gel® EX (Invitrogen), the distribution of fragments in the purified fraction was determined using a High Sensitivity Bioanalyzer kit and a 2100 Bioanalyzer Instrument system (Agilent). For equimolar pooling of the libraries, the relative concentration of the libraries was determined by realtime using Agilent QPCR Library Quantification Kit and a MX3005P instrument (Agilent). Finally, in order to determine the volume to use for sequencing, a second realtime was performed to measure the relative concentration of the pool compared to a previously sequenced ChIP library. Sequencing was performed as 50bp paired end on a GAIIx according to Illumina specifications using Cluster Generation Kit v4 and Sequencing Kit v4 in combination with illumina SCS 2.6/ RTA 1.6 software.