GSM2559370: chipseq.SRSF2P95H5h input rep1; Homo sapiens; ChIP-Seq
Sample information curated by ChIP-Atlas
Antigen
Antigen Class
Input control
Antigen
Input control
Cell type
Cell type Class
Kidney
Cell type
293
Primary Tissue
Kidney
Tissue Diagnosis
Normal
Attributes by original data submitter
Sample
source_name
HEK293T
rnaseh mutant
D210N
treatment
Dox
sample type
DNA
Sequenced DNA Library
library_strategy
ChIP-Seq
library_source
GENOMIC
library_selection
ChIP
library_construction_protocol
For R-ChIP, cells expressing mutant RNASEH1(D210N) were fixed followed by nuclei extraction. Chromatin DNA was sheared to 250-600 bp in size by sonication followed by incubation with magnetic beads conjugated with anti-V5 antibody overnight at 4°C. Beads were sequentially washed in high salt buffers to remove non-specifically bound protein and chromtin complexes. The enriched RNASEH1-RNA/DNA complex was eluted and decrosslinked overnight at 65°C. After sequential RNase A and Proteinase K treatment, the precipitated hybrid was cleaned by phenol and phenol:chloroform:isoamyl alcohol, followed by ethanol precipitation. The recovered fragment was subjected to library construction. For GRO-seq, the intact nuclei were extracted and mixed with run-on reaction buffer (10 mM Tris-HCl, pH 8.0, 5 mM MgCl2, 300 mM KCl, 1 mM DTT, 200 U/ml RNaseOut, 1% Sarkosyl, 500 μM ATP, 500 μM GTP, 500 μM Br-UTP and 2 μM CTP) for in vitro run-on reaction and Br-U labeling for 5 min at 30°C. The reaction was stopped by adding TRIzol LS reagent (Thermo Fisher). RNA was then extracted followed by treatment wtih DNase I (Promega) and antarctic phosphatase (NEB). For immunopurification, equilibrated and blocked anti-BrdU agarose beads (Santa Cruz) were mixed with RNA for 1 hr at 4°C. After binding, beads were thoroughly washed and BrU-incorporated RNAs were eluted. The BrU-RNA end was repaired by T4 PNK (NEB) and then subjected to poly-A tailing reaction. Tailed RNAs were reverse transcribed into cDNA by using superscript III (Thermo Fisher) and the GRO-seq RT primer (5’-pAGATCGGAAGAGCGTCGTGTAG;GCAGAAGACGGCATACGAGATTTTTTTTTTTTTTTTTTTTVN-3’), where p indicates 5’ phosphate; ‘;’ indicates the abasic dSpacer furan, and VN indicates degenerate nucleotides. The cDNA products were treated with Exonuclease I (NEB) for 1 hr at 37°C to eliminate excessive primer. The resultant cDNA was resolved in 10% polyacrylamide TBE-urea gel and the fraction in the size range of 100-400 bp was excised and recovered. For R-ChIP library construction, DNA from precipitated RNA/DNA hybrids was used as the template to generate dsDNA by random priming using a tail-containing N9 primer (5’- /invddt/CAAGCAGAAGACGGCATACGAGNNNNNNNNN-3’). An “A” base was then added to the 3’ end and the standard Illumina adaptor was ligated to one end of the resultant dsDNA. After purification,PCR were performed and the libraries in the size range of 130-350 bp were gel-isolated and purified. For GRO-seq library construction, cDNA was circularized and re-linearized. the libraries were amplified by PCR reaction. the final products were resolved in a non-denaturing 10% polyacrylamide TBE gel and libraries with the size 130-250 bp were recovered. R-ChIP and GRO-seq