Sample information curated by ChIP-Atlas

Antigen

Antigen Class
TFs and others
Antigen
AR

Cell type

Cell type Class
Prostate
Cell type
VCaP
Primary Tissue
Prostate
Tissue Diagnosis
Carcinoma

Attributes by original data submitter

Sample

source_name
human prostate cancer V-CaP cell line
treatment
Control
chip antibody
AR N-20 , Cat. #SC-816X, Santa Cruz

Sequenced DNA Library

library_strategy
ChIP-Seq
library_source
GENOMIC
library_selection
ChIP
library_construction_protocol
Total RNA was isolated using Trizol (Invitrogen) as per the manufacturer’s instructions. RNA was quantified by absorbance at 260 and 280nm using a NanoDrop ND-1000 (Wilmington, DE, USA). The quality of RNA was determined using an Agilent Bioanalyzer 2100 (Santa Clara, CA), requiring RIN (RNA Integrity Number) value of ≥6.5. rRNA depletion (cytoplasmic and mitochondrial) was performed on 200-400 ng of total RNA using the RiboZeroGold kit (Illumina, San Diego, CA) as per the manufacturer’s instructions. The entire rRNA-depleted fraction (ranging 4-22 ng) was used as input for library preparation using the ScriptSeq V2 RNA Seq library preparation kit (Illumina, San Diego, CA) as per the manufacturer’s instructions. Briefly, rRNA-depleted samples were chemically fragmented using the StarScript Reverse Transcriptase Buffer and the cDNA Synthesis Primer was annealed to the RNA. 5′ end-tagged cDNA (equivalent to the 3′ end of the original RNA) was produced by random-primed cDNA synthesis. This was followed by 3′-Terminal Tagging of the cDNA using the Terminal-Tagging Oligo to produce a template for cDNA extension. The resulting “di-tagged” cDNAs were purified using Qiagen MinElute PCR Purification Kit (Hilden, Germany), ligated to the NEBNext Illumina-compatible adaptor 5’-poGATCGGAAGAGCACACGTCTGAACTCCAGTC-U-ACACTCTTTCCCTACACGACGCTCTT CCGATC*T-3’ (*, phosphorothioate bond), and then indexed using the NEBNExt Universal primer, 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3’ plus 6-mer NEBNext indexed primer sets, 5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTG ACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3’, to allow multiplexing. The size of all libraries was assessed using the 2100 Bioanalyzer and a high sensitivity DNA chip (Agilent Technologies, Inc, CA), and further quantified with the Qubit DNA Broad Range assay (Life Technologies, Carlsbad, CA).

Sequencing Platform

instrument_model
Illumina HiSeq 2000

hg19

Number of total reads
168595962
Reads aligned (%)
52.9
Duplicates removed (%)
42.5
Number of peaks
2347 (qval < 1E-05)

hg38

Number of total reads
168595962
Reads aligned (%)
54.6
Duplicates removed (%)
41.1
Number of peaks
3190 (qval < 1E-05)

Base call quality data from DBCLS SRA