Total RNA was isolated using Trizol (Invitrogen) as per the manufacturer’s instructions. RNA was quantified by absorbance at 260 and 280nm using a NanoDrop ND-1000 (Wilmington, DE, USA). The quality of RNA was determined using an Agilent Bioanalyzer 2100 (Santa Clara, CA), requiring RIN (RNA Integrity Number) value of ≥6.5. rRNA depletion (cytoplasmic and mitochondrial) was performed on 200-400 ng of total RNA using the RiboZeroGold kit (Illumina, San Diego, CA) as per the manufacturer’s instructions. The entire rRNA-depleted fraction (ranging 4-22 ng) was used as input for library preparation using the ScriptSeq V2 RNA Seq library preparation kit (Illumina, San Diego, CA) as per the manufacturer’s instructions. Briefly, rRNA-depleted samples were chemically fragmented using the StarScript Reverse Transcriptase Buffer and the cDNA Synthesis Primer was annealed to the RNA. 5′ end-tagged cDNA (equivalent to the 3′ end of the original RNA) was produced by random-primed cDNA synthesis. This was followed by 3′-Terminal Tagging of the cDNA using the Terminal-Tagging Oligo to produce a template for cDNA extension. The resulting “di-tagged” cDNAs were purified using Qiagen MinElute PCR Purification Kit (Hilden, Germany), ligated to the NEBNext Illumina-compatible adaptor 5’-poGATCGGAAGAGCACACGTCTGAACTCCAGTC-U-ACACTCTTTCCCTACACGACGCTCTT CCGATC*T-3’ (*, phosphorothioate bond), and then indexed using the NEBNExt Universal primer, 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3’ plus 6-mer NEBNext indexed primer sets, 5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTG ACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3’, to allow multiplexing. The size of all libraries was assessed using the 2100 Bioanalyzer and a high sensitivity DNA chip (Agilent Technologies, Inc, CA), and further quantified with the Qubit DNA Broad Range assay (Life Technologies, Carlsbad, CA).