Sample information curated by ChIP-Atlas

Antigen

Antigen Class
TFs and others
Antigen
STAT5A

Cell type

Cell type Class
Blood
Cell type
Acute myeloid leukemia
NA
NA

Attributes by original data submitter

Sample

source_name
FLT3-ITD AML cell line
antibody
anti-Stat5
antibody manufacturer and catalog number
Santa Cruz Biotechnology; sc-835
cell type
AML
cell line
MV-4-11

Sequenced DNA Library

library_strategy
ChIP-Seq
library_source
GENOMIC
library_selection
ChIP
library_construction_protocol
Phenol-chloroform Libraries of DNA fragments from chromatin immunoprecipitation or DNase I treatment were prepared from approximately 10 ng of DNA. Firstly, overhangs were repaired by treatment of sample material with T4 DNA polymerase, T4 PNK and Klenow DNA polymerase (all enzymes obtained from New England Biolabs UK) in a reaction also containing 50 mM Tris-HCl,10 mM MgCl2, 10 mM Dithiothreitol, 0.4 mM dNTPs and 1 mM ATP. Samples were purified after each step using Qiagen MinElute columns (according to the manufacturer’s guidelines). Adenosine bases were added to 3’ ends of fragments using Klenow Fragment (3´- 5´ exo-minus), allowing for subsequent ligation of adapter oligonucleotides (Illumina part #1000521) using Quick T4 DNA ligase. After a further column clean up to remove excess adaptors, fragments were amplified in an 18 cycle PCR reaction using adapter-specific primers (sequences 5’- CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T and 5’-AATGATACGGCGACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T). The libraries were purified and adapter dimers removed by running PCR products on 2% agarose gels and excising gel slices corresponding to fragments approximately 200-300 bp in size, which were then extracted using the Qiagen gel extraction kit. Libraries were validated using quantitative PCR for known targets, and quality assessed by running 1 μl each sample on an Agilent Technologies 2100 Bioanalyser. Once prepared, DNA libraries were subject to massively parallel DNA sequencing on an Illumina Genome Analyzer.

Sequencing Platform

instrument_model
Illumina HiSeq 2000

hg19

Number of total reads
61412000
Reads aligned (%)
19.4
Duplicates removed (%)
79.7
Number of peaks
2852 (qval < 1E-05)

hg38

Number of total reads
61412000
Reads aligned (%)
20.5
Duplicates removed (%)
78.6
Number of peaks
2898 (qval < 1E-05)

Base call quality data from DBCLS SRA