Sample information curated by ChIP-Atlas


Antigen Class
TFs and others

Cell type

Cell type Class
Cell type

Attributes by original data submitter


Broker name
Protocols: CRISPR mediated KO of CIC: sgRNAs (Target sequence: mESCs: GCCTTCATGATCTTCAGCAAG; G144: GGGCGAGTGGTGGTATGCCC) were cloned into pSpCas9(BB)-2A-GFP (Addgene 48138) and transfected into mESCs (Lipofectamine 2000) or G144 cells (Amaxa Nucleofector II, Program A033). GFP-positive cells were single cell sorted 48h post-transfection, expanded and screened by immunoblotting for CIC deletion. MEK inhibition: Inhibitor treatment with 1 μM MEK inhibitor (PD0325901) was performed in 80% confluent cultures for 4 and 24 h respectively. DMSO was used as mock control. Cells were cross-linked (1% formaldehyde, 10 minutes), quenched with 125 mM glycine, washed twice with PBS and harvested in SDS buffer (50 mM Tris at pH 8.1, 0.5 % SDS, 100 mM NaCl, 5 mM EDTA). Cells were pelleted, resuspended in Triton-X IP buffer (100 mM Tris at pH 8.6, 0.3% SDS, 1.7% Triton X-100, and 5 mM EDTA) and chromatin was sonicated (fragment size 200-500bp). 25 µg chromatin (measured by Bradford) was pre-cleared with protein-A Sepharose beads (GE healthcare) for 1 hour and incubated with primary antibody overnight at 4oC. Protein-A Sepharose beads were blocked with 10 µg/ml BSA overnight at 4°C. Next day, beads and antibody/chromatin-mixture were incubated for 3 hours at 4oC. Beads were washed 3x with low salt buffer (1% Triton X-100, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, pH 8.0, 20 mM Tris-HCl, pH 8.0) and twice with high salt buffer (1% Triton X-100, 0.1% SDS, 500mM NaCl, 2 mM EDTA, pH8.0, 20 mM Tris-HCl, pH8.0). DNA was eluted with elution-buffer (1% SDS, 0.1 M sodium bicarbonate) at 65oC overnight and purified using QIAquick PCR Purification Kit (Quiagen). For ChIP-seq 1-2 ng of ChIP DNA was used for library preparation, using the NEBNext Ultra II DNA library prep kit (E7370; NEB).
ENA checklist
INSDC center alias
BRIC - Biotech Research and Innovation Centre
INSDC center name
BRIC - Biotech Research and Innovation Centre
INSDC first public
INSDC last update
INSDC status
SRA accession
Sample Name
glial cell
developmental stage
glioblastoma multiforme
wild type genotype
Homo sapiens
organism part

Sequenced DNA Library

CRISPR mediated KO of CIC: sgRNAs (Target sequence: mESCs: GCCTTCATGATCTTCAGCAAG; G144: GGGCGAGTGGTGGTATGCCC) were cloned into pSpCas9(BB)-2A-GFP (Addgene 48138) and transfected into mESCs (Lipofectamine 2000) or G144 cells (Amaxa Nucleofector II, Program A033). GFP-positive cells were single cell sorted 48h post-transfection, expanded and screened by immunoblotting for CIC deletion. MEK inhibition: Inhibitor treatment with 1 μM MEK inhibitor (PD0325901) was performed in 80% confluent cultures for 4 and 24 h respectively. DMSO was used as mock control. Cells were cross-linked (1% formaldehyde, 10 minutes), quenched with 125 mM glycine, washed twice with PBS and harvested in SDS buffer (50 mM Tris at pH 8.1, 0.5 % SDS, 100 mM NaCl, 5 mM EDTA). Cells were pelleted, resuspended in Triton-X IP buffer (100 mM Tris at pH 8.6, 0.3% SDS, 1.7% Triton X-100, and 5 mM EDTA) and chromatin was sonicated (fragment size 200-500bp). 25 µg chromatin (measured by Bradford) was pre-cleared with protein-A Sepharose beads (GE healthcare) for 1 hour and incubated with primary antibody overnight at 4oC. Protein-A Sepharose beads were blocked with 10 µg/ml BSA overnight at 4°C. Next day, beads and antibody/chromatin-mixture were incubated for 3 hours at 4oC. Beads were washed 3x with low salt buffer (1% Triton X-100, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, pH 8.0, 20 mM Tris-HCl, pH 8.0) and twice with high salt buffer (1% Triton X-100, 0.1% SDS, 500mM NaCl, 2 mM EDTA, pH8.0, 20 mM Tris-HCl, pH8.0). DNA was eluted with elution-buffer (1% SDS, 0.1 M sodium bicarbonate) at 65oC overnight and purified using QIAquick PCR Purification Kit (Quiagen). For ChIP-seq 1-2 ng of ChIP DNA was used for library preparation, using the NEBNext Ultra II DNA library prep kit (E7370; NEB).

Sequencing Platform

NextSeq 500


Number of total reads
Reads aligned (%)
Duplicates removed (%)
Number of peaks
1919 (qval < 1E-05)


Number of total reads
Reads aligned (%)
Duplicates removed (%)
Number of peaks
2556 (qval < 1E-05)

Base call quality data from DBCLS SRA