Sample information curated by ChIP-Atlas

Antigen

Antigen Class
TFs and others
Antigen
CIC

Cell type

Cell type Class
Neural
Cell type
Neural Stem Cells
MeSH Description
Self-renewing cells that generate the main phenotypes of the nervous system in both the embryo and adult. Neural stem cells are precursors to both NEURONS and NEUROGLIA.

Attributes by original data submitter

Sample

Alias
E-MTAB-6682:hNSC_18_5_DMSO_CIC
Broker name
ArrayExpress
Description
Protocols: CRISPR mediated KO of CIC: sgRNAs (Target sequence: mESCs: GCCTTCATGATCTTCAGCAAG; G144: GGGCGAGTGGTGGTATGCCC) were cloned into pSpCas9(BB)-2A-GFP (Addgene 48138) and transfected into mESCs (Lipofectamine 2000) or G144 cells (Amaxa Nucleofector II, Program A033). GFP-positive cells were single cell sorted 48h post-transfection, expanded and screened by immunoblotting for CIC deletion. MEK inhibition: Inhibitor treatment with 1 μM MEK inhibitor (PD0325901) was performed in 80% confluent cultures for 4 and 24 h respectively. DMSO was used as mock control. Cells were cross-linked (1% formaldehyde, 10 minutes), quenched with 125 mM glycine, washed twice with PBS and harvested in SDS buffer (50 mM Tris at pH 8.1, 0.5 % SDS, 100 mM NaCl, 5 mM EDTA). Cells were pelleted, resuspended in Triton-X IP buffer (100 mM Tris at pH 8.6, 0.3% SDS, 1.7% Triton X-100, and 5 mM EDTA) and chromatin was sonicated (fragment size 200-500bp). 25 µg chromatin (measured by Bradford) was pre-cleared with protein-A Sepharose beads (GE healthcare) for 1 hour and incubated with primary antibody overnight at 4oC. Protein-A Sepharose beads were blocked with 10 µg/ml BSA overnight at 4°C. Next day, beads and antibody/chromatin-mixture were incubated for 3 hours at 4oC. Beads were washed 3x with low salt buffer (1% Triton X-100, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, pH 8.0, 20 mM Tris-HCl, pH 8.0) and twice with high salt buffer (1% Triton X-100, 0.1% SDS, 500mM NaCl, 2 mM EDTA, pH8.0, 20 mM Tris-HCl, pH8.0). DNA was eluted with elution-buffer (1% SDS, 0.1 M sodium bicarbonate) at 65oC overnight and purified using QIAquick PCR Purification Kit (Quiagen). For ChIP-seq 1-2 ng of ChIP DNA was used for library preparation, using the NEBNext Ultra II DNA library prep kit (E7370; NEB).
ENA checklist
ERC000011
INSDC center alias
BRIC - Biotech Research and Innovation Centre
INSDC center name
BRIC - Biotech Research and Innovation Centre
INSDC first public
2018-05-30T17:02:00Z
INSDC last update
2018-04-24T13:06:01Z
INSDC status
public
SRA accession
ERS2429021
Sample Name
ERS2429021
Title
hNSC_18_5_DMSO_CIC
age
18.5
cell_type
neural stem cell
developmental stage
late embryo
disease
normal
genotype
wild type genotype
organism
Homo sapiens
organism part
brain

Sequenced DNA Library

library_name
hNSC_18_5_DMSO_CIC_s
library_strategy
ChIP-Seq
library_source
GENOMIC
library_selection
ChIP
library_construction_protocol
CRISPR mediated KO of CIC: sgRNAs (Target sequence: mESCs: GCCTTCATGATCTTCAGCAAG; G144: GGGCGAGTGGTGGTATGCCC) were cloned into pSpCas9(BB)-2A-GFP (Addgene 48138) and transfected into mESCs (Lipofectamine 2000) or G144 cells (Amaxa Nucleofector II, Program A033). GFP-positive cells were single cell sorted 48h post-transfection, expanded and screened by immunoblotting for CIC deletion. MEK inhibition: Inhibitor treatment with 1 μM MEK inhibitor (PD0325901) was performed in 80% confluent cultures for 4 and 24 h respectively. DMSO was used as mock control. Cells were cross-linked (1% formaldehyde, 10 minutes), quenched with 125 mM glycine, washed twice with PBS and harvested in SDS buffer (50 mM Tris at pH 8.1, 0.5 % SDS, 100 mM NaCl, 5 mM EDTA). Cells were pelleted, resuspended in Triton-X IP buffer (100 mM Tris at pH 8.6, 0.3% SDS, 1.7% Triton X-100, and 5 mM EDTA) and chromatin was sonicated (fragment size 200-500bp). 25 µg chromatin (measured by Bradford) was pre-cleared with protein-A Sepharose beads (GE healthcare) for 1 hour and incubated with primary antibody overnight at 4oC. Protein-A Sepharose beads were blocked with 10 µg/ml BSA overnight at 4°C. Next day, beads and antibody/chromatin-mixture were incubated for 3 hours at 4oC. Beads were washed 3x with low salt buffer (1% Triton X-100, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, pH 8.0, 20 mM Tris-HCl, pH 8.0) and twice with high salt buffer (1% Triton X-100, 0.1% SDS, 500mM NaCl, 2 mM EDTA, pH8.0, 20 mM Tris-HCl, pH8.0). DNA was eluted with elution-buffer (1% SDS, 0.1 M sodium bicarbonate) at 65oC overnight and purified using QIAquick PCR Purification Kit (Quiagen). For ChIP-seq 1-2 ng of ChIP DNA was used for library preparation, using the NEBNext Ultra II DNA library prep kit (E7370; NEB).

Sequencing Platform

instrument_model
NextSeq 500

hg19

Number of total reads
24016218
Reads aligned (%)
77.6
Duplicates removed (%)
18.9
Number of peaks
795 (qval < 1E-05)

hg38

Number of total reads
24016218
Reads aligned (%)
79.5
Duplicates removed (%)
17.7
Number of peaks
896 (qval < 1E-05)

Base call quality data from DBCLS SRA